Construye un cohete accionado por burbujas

cohete accionado por burbujasEn la página web de la NASA hay algunas actividades para chicos que están muy buenas. Una de ellas es este fabuloso juguete-experimento que consiste en hacer despegar un cohete de papel propulsado con burbujas efervecentes. Incluso se puede usar el cohete de papel del que hablé anteriormente, modificandolo para poder usarlo en este experimento.

…………………………………………………………………………………………………….

Materiales:

  • Papel normal de 216 por 279 mm (8-1/2 por 11 pulg.), como el papel para impresoras o incluso una hoja de cuaderno.
  • Un recipiente plástico para rollos de película de 35 mm
  • Cinta adhesiva transparente
  • Tijeras
  • Una tableta antiácida efervescente (de las que se toman para el malestar estomacal)
  • Toallas de papel
  • Agua
  • Protección para los ojos (como lentes, gafas oscuras o gafas de seguridad)

Construcción del cohete:

Primero debes decidir cómo recortar el papel. Puedes recortarlo a lo ancho o a lo largo para hacer el cuerpo del cohete. No hay una sola forma correcta de hacer un cohete de papel. Prueba con un cohete largo y delgado, o uno corto y gordo. Prueba con una nariz en punta o plana. Prueba con alerones o sin alerones. ¡Experimenta!

Ésta es sólo una idea de cómo podrías hacer todo el cohete con una sola hoja de papel:

Cohete en papel

 

Los pasos básicos son:

1. Corta todas las piezas del cohete.
2. Enrolla y pega con cinta un tubo de papel alrededor del recipiente para rollos de película. Consejo: Pega el final del papel al recipiente antes de comenzar a enrollar.¡Importante! Coloca el extremo con tapa del recipiente hacia abajo.
3. Si deseas, puedes pegarle alerones al cuerpo del cohete.
4. Enrolla el círculo (al cual se le ha cortado una cuña) para formar un cono y pégalo con cinta en la parte superior del cohete.

Despegue:

1. Colócate la protección para los ojos.
2. Voltea el cohete y quita la tapa del recipiente.
3. Llena un tercio del recipiente con agua.

¡Los siguientes pasos debes hacerlos rápidamente!

1. Coloca media tableta antiácida efervescente en el recipiente.
2. Coloca firmemente la tapa del recipiente.
3. Coloca el cohete en una plataforma de despegue, como la acera o la entrada de vehículos de tu casa.
4. Retrocede y espera. ¡El cohete despegará!

cohete accionado por burbujas

Fuente: Nasa

Anuncios

36 Responses to “Construye un cohete accionado por burbujas”


  1. 1 JOSE LUIS agosto 22, 2007 en 18:40

    bonito…

  2. 2 frank septiembre 10, 2007 en 15:30

    aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa donde estan las instrucciones

  3. 3 Ricardo febrero 5, 2008 en 19:17

    Creo ke el ResipienTe es alGo dificil de CONsEGUIr ……… deverian poner otrAS opcioNes mas conocidaAs

  4. 4 marylu alejandro abril 24, 2008 en 21:12

    podriamos utilizar otro recipiente o donde se puede conseguir?

  5. 5 lorena mayo 18, 2008 en 23:15

    muchas gracias ahora puedo hacer mi trabajo practico

  6. 6 johanna mayo 30, 2008 en 19:00

    la verdad esta muy bacano

  7. 7 eliana julio 23, 2008 en 23:08

    mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeoooooooooooooooooooooooooooooooooooooooobccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccceeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee

  8. 8 milena julio 23, 2008 en 23:10

    m td6yyyyyyfxzncbn,vmnkpaos<pz<ywi3qo2198439850jzkxmc,n<zm<x zvclx,vkosu9q8w’127134450385555555555555555

  9. 9 camilo agosto 15, 2008 en 22:00

    mmmmm… me podria servir pero seria algo factible??????
    aunq igual loi voy a provar…
    para mi proyecto de escuela .

  10. 10 DEYVID septiembre 22, 2008 en 10:08

    LA VERDAD ES MUY VACANO PERO LO UNICO QUE LE HACE FALTA ES MAS INFORMACION QUE SE NESESITA PARA CONSTRUIRLO

  11. 11 carol octubre 6, 2008 en 18:38

    que chevere el esperimento

  12. 12 daniel octubre 8, 2008 en 21:57

    holas
    el esperimento suena bueno pero la verdad hoy en dia buscamos experimentos con mas potencia al que espe nos puede dar
    pero de todas maneras esta bueno y espero que publique otros con mas potencia, grasiaaaaaaa

  13. 13 carlos octubre 15, 2008 en 19:30

    esta pgina me fasina

  14. 14 agustin octubre 19, 2008 en 9:47

    muy bueno pero se pedria usar un resipiente plastico o algo que ser ligero como un enbase donde viene el tape

  15. 15 camila diciembre 4, 2008 en 19:45

    q no se puede acer
    en un auto

  16. 16 KARIANNY GIANGREGORIO diciembre 18, 2008 en 18:46

    ES MUY RICO
    Y LINDO Y ADEMAS LE FALTA ALGO POR Q NO HACEN NADA DE SEXO NI ALGO DE COJER O BESUQUIARSE MUAAAAAAAAA!

  17. 19 mila marzo 13, 2009 en 9:43

    Hola! Esta increible lo facil de hacer pero me gustaria que pongan algo aun mas sencillo para ninos de escuela ya que este proyecto es como para jovenes de secundaria gracias

  18. 20 maritza agosto 9, 2009 en 1:20

    me encanto muy bueno pero no tengo el recipiente en q mas se puede hacer

    • 22 carlitos octubre 13, 2009 en 19:57

      guaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguaguagua…

  19. 23 ghhokoghr diciembre 25, 2009 en 19:36

    me gustaria que pusieran un pco mas de informacion de este proyecto

  20. 25 phiromax marzo 12, 2010 en 14:16

    es lo mas mierda k e visto

  21. 26 phiromax marzo 12, 2010 en 14:18

    el de pa pornografia es el tio pas tonto k me e echao a la cara

  22. 27 RAVM junio 7, 2010 en 15:30

    NO SE PUEDE USAR BI CARBONATO DE SODIO

  23. 28 nestor septiembre 6, 2010 en 10:01

    La verdad es que me han puesto un 5 se tiene que mejorar

  24. 29 elCUERVITO septiembre 14, 2010 en 23:11

    HOLA me llamo Nahuel tengo 9 años y ese cohete parece muy bueno pero pregunto como es posible q un cohete de papel se impulse con burbujas

  25. 30 elCUERVITO septiembre 14, 2010 en 23:15

    yo diria q es posible q las burbujas tuvieran tanta fuerza por el peso del cohete y la gravedad y mis calculos pienso q es imposible ¿USTEDES QUE PIENSAN?

  26. 32 Pablo octubre 3, 2010 en 13:32

    El señor administrador de esta web podría dignarse, en primer lugar, de contestar los comentarios, pues en otros post tampoco lo ha hecho. Si no tiene tiempo, pues para que tiene una web.
    En segundo lugar, las instrucciones están mal e incompletas. Una ayuda:
    Cualquier recipiente pequeño y que cierre a pesión servirá. Hay unos de M&M minis, que funcionan perfecto, y otros de dulces que también sirven.
    El recipiente debe quedar adentro del cohete, con la tapa hacia abajo, y debe permitirse poner la tapa.
    Luego, lo que se hace es poner la tableta CON UN POCO AGUA, que si no les saldrá barba esperando que pase algo.
    Acá en Chile venden algo llamado carburo, que se usaba antiguamente para encender lámparas. Funciona mejor que la tableta antiácida.
    Por si las dudas, debe ser muy poca agua, pero les aconsejo que vayan probando y experimentando ustedes mismos que de eso se trata.

    Saludos!

  27. 33 devvone febrero 23, 2011 en 19:29

    no es muy facil de hacer k digamos pq como despega con poquita pastilla

  28. 34 kenneth marzo 8, 2012 en 23:50

    tengo 5 años, esta bien no voy a renunciar hasta lograrlo.

  29. 35 catalina moscote abril 8, 2013 en 20:59

    esta pagina es fantastica para ser un cohete,carro.etc esta pagina deberinnser ser mas visittada por mas personas o no?

  30. 36 kenneth cole mayo 29, 2013 en 22:01

    I am genuinely thankful to the owner of this web site who has shared this wonderful paragraph at at this place.


Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s





A %d blogueros les gusta esto: